RNA-Seq of UHRR: strand specific
Source: CNGBdb Experiment (ID CNX0048126)
Source: CNGBdb Experiment (ID CNX0048126)
Platform: DNBSEQ-G400(MGISEQ-2000)
Library name: MGIRNAStr2
Library layout: paired
Library strategy: RNA-Seq
Library source: TRANSCRIPTOMIC
Library selection: Oligo-dT
Design description: MGIEasy RNA Directional Library Prep Set was used to construct library with enriched UHRR (universal Human Reference RNA) mRNA. The library was sequenced on MGISEQ-2000 platform for PE150. 3' adapter: AAGTCGGAGGCCAAGCGGTCTTAGGAAGACAA ; 5' adapter: AAGTCGGATCGTAGCCATGTCGTTCTGTGAGCCAAGGAGTTG
Release date: 2019-03-22
Last updated: 2021-07-01
chevron_leftchevron_right
Run ID | Platform | Library layout | Organism | Sample ID | Project ID | Operation |
---|