Computational and Analytical Framework for Small RNA Profiling by High-Throughput Sequencing (standards)
Source: NCBI BioProject (ID PRJNA114413)

0 0

Project name: Arabidopsis thaliana
Description: The purpose of this work was to describe a computational and analytical methodology for profiling small RNA by high-throughput sequencing. The datasets here were used to develop synthetic oligoribonucleotides as spike-in standards.Overall design: We assessed the use of synthetic oligoribonucleotide standards as spike-in controls. These standards can be used to set an objective standard against which to compare samples. Standards were added to the total RNA (100 ug) in the following amounts: Std2 (TATATGCAAGTCCGGCCATAC) 0.01 pmol, Std3 (TAGCTAACGCATATCCGCATC) 0.1 pmol, Std6 (TGAAGCTGACATCGGTCATCC) 1.0 pmol.
Data type: Transcriptome or Gene expression
Sample scope: Multiisolate
Relevance: ModelOrganism
Organization: James C. Carrington, Donald Danforth Plant Science Center
Literatures
  1. PMID: 19307293
Release date: 2009-06-03
Last updated: 2009-02-03
Statistics: 3 samples; 3 experiments; 3 runs