16S rDNA Sanger sequencing of LAB isolates
Source: CNGBdb Project (ID CNPhis0000069)

0 0

Description: Genomic DNA of isolates were extracted and 16S rDNA genes were amplified with universal primers (27F: 5’ AGAG-TTTGATCCTGGCTCAG 3’; 1492R: 5’ AAGGAGGTGATCCAGCCGCA 3’).
Data type: Other
Sample scope: Monoisolate
Organization: BGI-SHENZHEN
Accession in other database: PRJEB21368
Literatures
  1. PMID: 28783248
Last updated: 2017-08-22
Statistics: 94 samples; 94 experiments; 94 runs